0 ; Silk fibres are valso animal fibres. …. 2 ; … Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. We use silk to make clothes and apparels. Question 3. for your conclusion. Both the statements are correct statements. India Climate Vegetation and Wildlife. Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. These eggs hatch into caterpillar or larvae. 1 Answer. Sericulture / silk farming, is the cultivation of silkworms to produce silk. The important inputs like seeds, fertilisers, machinery etc form a system called as? ANSWER. Mention it's characteristics? Sericulture is the process of cultivating silkworms and extracting silk from them. balanced equation and give evidence What is called reeling the silk? It is also known as shifting cultivation. They develop by eating leaves of this plant. Sericulture is rearing of silkworms for production of silk. The above-given table gives the complete structure of the AP Village Sericulture Assistant Test Pattern 2020. What is horticulture? What does gyrase do during DNA replication? Want to see this answer and more? Answer . SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. Shifting cultivation is also known as Milpa in which part of the world. Upvote(0) How satisfied are you with the answer? Define sericulture. Question 8. Sericulture is the process of raising silkworms for their silk. Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. Sericulture is a process of rearing of silkworm to obtain silk. As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. But have you ever wondered where silk came from? You may refer to the answer provided by your friends @Others..Good work..keep posting! Why is petroleum reffered to as liquid gold? 0 ; it is the rearing of silk worms for commercial purposes. C. Both of the above. Books. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels • Bombyx mori is the most widely used species of silkworm and intensively studied. What is sericulture ? A uneven twill B. Sericulture C. dying D. Ikat-technique 11. 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. What is sericulture? Which country is the leading producer of wool? Answer: (b) Mexico. Download PDF's. Explain 6) The silk solidifies when it comes in contact with air. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Sericulture is a cottage industry. chromosomes. Wiki User Answered . In commercial cultivation, the mulberry garden is generally established through stem cuttings. A student proposed that the balanced chemical equation for this reaction is: Courtesy : wikipedia (a) 75% (b) 85% (c) 65% (d) 50%. Sericulture is the process of cultivating silkworms and extracting silk from them. Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. Question 14. Wiki User Answered . Answer. Which arrow or arrows represent a release of carbon dioxide? 1 Thank You. What are the problems of Indian agriculture? Top Answer. Answered By . (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. Answer: It is known as Jhumming’ in the north-eastern region of India. …, 27. Find more answers . Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Other types of silkworms (such as Eri, Muga, and … Historically sericulture was introduced in china by hoshomin, the queen of china. Note: There will be a negative marking of (1/4) or 0.25 mark for each wrong answer. What kind of silk worms are reared in Nepal? Hence sericulture or silk production is dependent on moriculture. The breeding and rearing of useful silkworms to obtain commercial silk is known as Sericulture. Sericulture is rearing of silkworms for production of silk. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? The best one gets 25 in all. Get 5 credit points for each correct answer. The stages of silk production are as follows. Explanation: not under stand search in google. Answer. toppr. The stages of silk production are as follows. your answer. Category : General Knowledge: Question 928: What is sericulture?. Sericulture is also known as silk farming. tiny bubbles to deliver them where they need to go. * See Answer *Response times vary by subject and question complexity. These eggs are stored over a clean paper or piece of cloth. 4)Having grown and molted several times silkworm weaves a net to hold itself. View Full Answer rearing of silkworms is known as sericulture. NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. Answer. Thank you. II. Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, …. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Recommend (0) Comment (0) person. What is sericulture? 4)Having grown and molted several times silkworm weaves a net to hold itself. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. Sericulture, or silk farming, is the cultivation of silkworms to produce silk. Answered By . One coccon contains approximately 1000 yards of silk filaments. Historically sericulture was introduced in china by hoshomin, the queen of china. tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. Describe the process or processes you selected. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Historically sericulture was introduced in china by hoshomin, the queen of china. 7. The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. Answer. Sericulture is the practice of . The study of silkworms is called Sericulture. Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … Define Sericulture. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Fibre to Fabric Class 6 Extra Questions Short Answer Type. Ask your question. The rearing of silkworms for obtaining silk is called sericulture. Question 8. Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. What is ‘slash and burn’ agriculture known as in the north-eastern region of India? It is a very old occupation in India. The stages of silk production are as follows. It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. No comments: Post a Comment. Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! Answer: (d) 50%. Chemistry. Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples Paragraph on Sericulture! Question 7. (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. The sericulture is an important cottage industry, but is now the basis of large industries in China, Japan, India and some European countries, where the silkworm, Bombyx mori is reared on mulberry leaves on a mass scale to get raw silk from the cocoons of the caterpillars of the moth. Answer: When the packaging warehouse of the cell is done with the proteins, it loads them into Answer. Still have questions? 0 votes . Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Which organelle is this . question_answer. It is the rearing of silkworms to obtain silk. In simple terms, it is the cultivation of silkworms to produce silk. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Question 8. Find answers to questions asked by student like you. The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. Determine whether this is a correctly 2.Motion • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Median response time is 34 minutes and may be longer for new subjects. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. Sericulture is the process of cultivating silkworms and extracting silk from them. Without the organelle that does this, the animal Explain Answer: Coconut 2. chain, identifying the codons, anticodons, and amino acid s Question 25. Question 24. 9. (ii) Muslim rule was established in Delhi at the end of the 12th century. Sericulture is also known as silk farming. Explore the MCQs for chapter 16 Management of Natural Resources. If you need more info, try doing a search on sericulture. Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. Sericulture is the process of raising silkworms for their silk. 1 ; MULBERY CULTIVATION. (a) North East India (b) Mexico (c) Brazil (d) Malaysia. Find more answers. Sericulture is an agro-based industry. Elaborate on planning region? Class-6 » Social Science. Kumar adityadev. Top Answer. 1)The silk moth lays thousands of eggs. The rearing of silkworms for obtaining silk is called sericulture. … Show more Q&A. New questions in Art. cell won't be able to What is meant by rain shadow area? Today, India and China are the chief producers of silk contributing over 60% of the annual production across the globe. Labels: General Knowledge. Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Share 6. 6. ADVERTISEMENTS: Paragraph on Sericulture! What are th Answer is : Growing Silkworms: Posted by MC at 7:40 PM. What is sericulture? NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. Silk was believed to have first been produced in China as early as the Neolithic Period. Answer: (d) sericulture. Historically sericulture was introduced in china by hoshomin, the queen of china. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Newer Post Older Post Home. Question 6. Define sericulture. Sericulture is also known as silk farming. Share with your friends. This is cruelty against insects. Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. 1.Force You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. Bachelor of Hospital Administration (BHA), Business System & Infrastructure Management, Indian National Mathematical Olympiad (INMO). Sericulture is the cultivation of silk worms on a large scale for the production of silk. 2015-08-01 13:52:09 2015-08-01 13:52:09 . ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. Gaurav Teharpuria. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Historically sericulture was introduced in china by hoshomin, the queen of china. Sericulture: The rearing of silkworms for obtaining silk is called sericulture. Give an example and state the mount... Why most of the south indian rivers flow east ? MEDIUM. Rearing of silk worms for obtaining silk is called sericulture. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. What fabric is found in Vietnam? Question 15. you selected? Answer: (b) Viticulture. why this is true or false. NCERT RD Sharma Cengage KC Sinha. 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. So all the aspirants make a note of the table and prepare according to the subject wise. Ans: the lultivation of silk worm is called sericulture. Download PDF for offline reading FREE only at BYJU’S. 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. (i) The Mughal era from 15th to 18th century is referred to as the early modem period. Answer: The rearing of silk moths for the production of silk is called sericulture. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. About 2500 silkworms are required to produce one pound of raw silk. What is sericulture? 2. 2015-08-01 13:52:09 2015-08-01 13:52:09 . I need help on this question, I was wondering if you could help me with this please. 10. Question 1. Answer. Sericulture is the whole process of obtaining silk starting from silk moth. The rearing of silkworms for the production of raw silk is known as sericulture. Upvote(0) How satisfied are you with the answer? Regards. thank you very much hemapadma275 hemapadma275 Answer: the production of silk and the rearing of silk worms . Question 1. …. Sericulture is the process of rearing of silk worm for obtaining silk. Why do we need clothes? General Knowledge Questions and Answers about Agriculture 1. • Stages of production of silk • The silk moth lays eggs. They are also called silk Moths. Silk was believed to have first been produced in China as early as the Neolithic Period. Which are the important plantation crops in India? cal energy to mechanical energy. Exhaustive questions with answers are provided. Get copy of last few answers in your mail. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. True or False. Answer. Ask & Answer; School Talk; Login; GET APP; Login Create Account. The rearing of silkworms for obtaining silk is called sericulture. D. None of the above. Rearing of silkworm to produce raw silk is called sericulture. Sericulture; Answer: 1. Tagged in. the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. a. 9) The silk filaments are then wound on a reel . Sericulture, floriculture, moriculture, apiculture and silviculture. What is called reeling the silk? | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Given below is a sequence of steps in the processing of wool. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. toppr. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. The arrow labeled C represents a transfer of chemi Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Recommend (0) Comment (0) person. Which fibre is the expensive fibre? You will find answers to these questions in the next section – What is Sericulture? 1)The silk moth lays thousands of eggs . The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Question 7. answered by Lifeeasy Authors. divide and will die. It is a very old occupation in India. Related Biology Q&A. Using the diagram above, answer the following questions: Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … Sericulture is the raising of silk worms. They are reared in Sericulture. Question 3. (a) Barter system (b) Water system (c) Farm system (d) All of these. The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Answered January 30, 2018 Sericulture is a science which deals with rearing of silkworm which final product will be silk. (iii) Arab Muslims had been trading in the ports of the west coast. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? Silk worms are beneficial and useful insects. Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * The arrow labeled A represents a transfer of solar energy to chemical energy. Sericulture is the process of cultivating silkworms and extracting silk from them. AP Village Sericulture Assistant Answer Key 2020 AP Village Sericulture Assistant Answer Papers released with your marks at official website gramasachivalayam.ap.gov.in. Answer: Australia. Find out the correct statement. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . 8. Rearing: The bringing up and looking after the sheep is called rearing. Email This BlogThis! Answer: Silk. 3. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. …, When an animal cell is ready to divide, it begins to make long fibers that attach to the True or False. What per cent of persons are engaged in agricultural activity in the world? These are two types of silk worm reared in Nepal, i.e. 0 ; View Full Answer Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. 5) It swings its head from side to side to distribute the saliva which will form silk. b. But the art of sericulture was held by … What is sorting? Sericulture is the production of silk and the rearing of silkworms for this purpose. Question 8. 1)The silk moth lays thousands of eggs . Explain why this is true or false. Silk firer is obtained from silk worms in sericulture. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? Still have questions? Sericulture. Question 4. The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, Sericulture is the whole process of obtaining silk starting from silk moth. Top Answer. Root wilt and Bud rot are the major diseases of? This is from wikipedia, I hope it helps. It is the rearing of silkworms to obtain silk. Answer… Answer: Sorting is the process of separating the different textures of hair. 0 rearing of silk. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. 2014: Cool online Exam AtoZ General Knowledge Questions and Answers. 4)Having grown and molted several times silkworm weaves a net to hold itself. 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. Silkworms spin the ' silk fibres'. wHAT IS SERICULTURE. Biology . Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. What is sericulture?. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. …, equence. ask related question comment. Describe the structure of a silkworm with a diagram. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. This practice has existed for a very long time. Wiki User Answered . Maths. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Answer. Question 5. MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. 2014-06-11 21:45:12 2014-06-11 21:45:12. Question 2. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Answer. It may supplement the income of the farmer. The rearing of silkworms for the production of raw silk is known as sericulture. The cultivation of crops is done for personal consumption. What process is occurring at the arrow(s) It involves low levels of technology and household labour to produce a small output. Answer: The rearing of silkworms for obtaining silk is called as sericulture. Find 4 Answers & Solutions for the question What is sericulture? Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. Eri-silkworm and seri-silkworm, etc. Answer: (a) Sericulture. Question 9. • The eggs hatch, and the larvae feed on mulberry leaves. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Answer these questions. Silkworms are used to produce silk. add. This process is called shearing. Physics. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. Share to Twitter Share to Facebook Share to Pinterest. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). Ask your question. Answer. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family.